Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.011147 |
Chromosome: | chromosome 1 |
Location: | 6444300 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g045800 | (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCCGTACTAGCTCCTCT |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 559 |
LEAP-Seq percent confirming: | 81.25 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGACCGGTAGTATGGCTGC |
Suggested primer 2: | GCCGCATCTCGTAGAAAGTC |