Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.011223 |
Chromosome: | chromosome 12 |
Location: | 1293297 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g489000 | (1 of 10) PF00170 - bZIP transcription factor (bZIP_1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTATCATGTTGATGCCAAG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1381 |
LEAP-Seq percent confirming: | 97.9103 |
LEAP-Seq n confirming: | 1593 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTGCCTAACGGTGAGTGT |
Suggested primer 2: | AAGCCATCAAGAGGCGAGTA |