Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.011458 |
Chromosome: | chromosome 12 |
Location: | 1308183 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g488850 | AP2A1 | Alpha2-Adaptin; (1 of 1) K11824 - AP-2 complex subunit alpha (AP2A) | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCTTCCAAAGGCAGCTG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1276 |
LEAP-Seq percent confirming: | 99.0811 |
LEAP-Seq n confirming: | 2480 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGAGCTGTGACGGGTATT |
Suggested primer 2: | GCTCTGCGGGTTACTGCTAC |