| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.011963 |
| Chromosome: | chromosome 2 |
| Location: | 6503519 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116500 | CPY3 | Serine carboxypeptidase; (1 of 1) PTHR11802:SF30 - PROTEIN Y16B4A.2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCCGCGCGTATGAGGAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1298 |
| LEAP-Seq percent confirming: | 99.835 |
| LEAP-Seq n confirming: | 605 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCAGAGTGCCGTACTTC |
| Suggested primer 2: | CACCTCAAGTTTCACGCAAA |