Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.011992 |
Chromosome: | chromosome 2 |
Location: | 6307711 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g114800 | (1 of 1) PF14934 - Domain of unknown function (DUF4499) (DUF4499) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATCCGCGAACCGGGAACTC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 576 |
LEAP-Seq percent confirming: | 76.7123 |
LEAP-Seq n confirming: | 56 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCACTGCCAAGACCACTA |
Suggested primer 2: | CAGTGTCTCTGACGCCACAT |