Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.012120 |
Chromosome: | chromosome 1 |
Location: | 6130056 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g043800 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTTTGTCATTGGGAAGGT |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 842 |
LEAP-Seq percent confirming: | 99.3671 |
LEAP-Seq n confirming: | 157 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGGCTGACTATTGGGACA |
Suggested primer 2: | TCCATCATGCCGTACACACT |