| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.012248 |
| Chromosome: | chromosome 3 |
| Location: | 5750798 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g188300 | RBOL1,RBO1 | (1 of 2) 1.6.3.1 - NAD(P)H oxidase (H(2)O(2)-forming) / Thyroid oxidase 2; Respiratory burst oxidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGCGGTCGTTGTCCCGGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1230 |
| LEAP-Seq percent confirming: | 99.2188 |
| LEAP-Seq n confirming: | 254 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTACGTGGAACACAACGC |
| Suggested primer 2: | ACACCGTATCTTGCACTCCC |