| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.012288 |
| Chromosome: | chromosome 13 |
| Location: | 1493899 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572650 | POB13 | Proteome of basal body 13 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGAGCCCTCGGAATAAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 878 |
| LEAP-Seq percent confirming: | 90.3226 |
| LEAP-Seq n confirming: | 84 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCTGGTACTGCTGGAAGG |
| Suggested primer 2: | CAAGTCTAGACCGACGCACA |