| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.012484 |
| Chromosome: | chromosome 12 |
| Location: | 2244727 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g508050 | (1 of 1) PF01388//PF12047//PF15612 - ARID/BRIGHT DNA binding domain (ARID) // Cytosine specific DNA methyltransferase replication foci domain (DNMT1-RFD) // WSTF, HB1, Itc1p, MBD9 motif 1 (WHIM1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCGCGAGCCACCATCGTC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 670 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTAATTGCGCCGAGATAA |
| Suggested primer 2: | GTTTCCAAACACGGCAGATT |