| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.012527 |
| Chromosome: | chromosome 10 |
| Location: | 965469 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424750 | PPD1 | (1 of 2) 2.7.9.1 - Pyruvate, phosphate dikinase / Pyruvate,phosphate dikinase; Pyruvate phosphate dikinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACGTCATCTGGGTCAGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1208 |
| LEAP-Seq percent confirming: | 82.585 |
| LEAP-Seq n confirming: | 607 |
| LEAP-Seq n nonconfirming: | 128 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATCAGCTGCTGGCTTCAT |
| Suggested primer 2: | CCTACTGCACACGGCAATAA |