| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.012785 |
| Chromosome: | chromosome 17 |
| Location: | 155541 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g697300 | CEP16 | Cysteine endopeptidase; (1 of 1) 2.7.11.1//3.4.22.67 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Zingipain / Zingibain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCTGAGTATCTGTTTGC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1467 |
| LEAP-Seq percent confirming: | 96.8105 |
| LEAP-Seq n confirming: | 516 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCCTGTAAACCATCCAT |
| Suggested primer 2: | ACCCCAGCTTACACAAATGC |