| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.013088 |
| Chromosome: | chromosome 9 |
| Location: | 1930056 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395100 | MKP4 | (1 of 3) K14165 - atypical dual specificity phosphatase [EC:3.1.3.16 3.1.3.48] (K14165); Dual-specificity protein phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTGAGAAGCCCGGAAAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 942 |
| LEAP-Seq percent confirming: | 99.2857 |
| LEAP-Seq n confirming: | 278 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGGCTGTTACTCCAGGCT |
| Suggested primer 2: | TTAATCTGCGTCCCGCTTAC |