Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.SG0182.013135 |
Chromosome: | chromosome 8 |
Location: | 3899106 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g378150 | GLD2 | Glucose-6-phosphate dehydrogenase; (1 of 2) 1.1.1.49 - Glucose-6-phosphate dehydrogenase (NADP(+)) / GPD | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGAGTGTCACTCTCGTTC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 893 |
LEAP-Seq percent confirming: | 99.3939 |
LEAP-Seq n confirming: | 164 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGACGTCTGCCTATGCTTG |
Suggested primer 2: | GTGCTAGGCAAGTACGAGGG |