| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.013184 |
| Chromosome: | chromosome 10 |
| Location: | 1287381 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427300 | PF24,RSP2 | Radial Spoke Protein 2; (1 of 1) PTHR23356//PTHR23356:SF5 - DPY30-RELATED // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGGGCAAGCGATGACAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1476 |
| LEAP-Seq percent confirming: | 98.3438 |
| LEAP-Seq n confirming: | 3147 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACTTGACTTGGTGGGTGC |
| Suggested primer 2: | CGCTAGAGGACAGGAAGTGG |