Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.013272 |
Chromosome: | chromosome 12 |
Location: | 4436195 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g521200 | RFC1 | (1 of 1) K10754 - replication factor C subunit 1 (RFC1); DNA replication factor C complex subunit 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACAAGGTGCGGCCGCAG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1368 |
LEAP-Seq percent confirming: | 98.9247 |
LEAP-Seq n confirming: | 460 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGGTCCCACGACAACTAA |
Suggested primer 2: | TAGCCGTTTACTGGGATTGG |