| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.013283 |
| Chromosome: | chromosome 9 |
| Location: | 836709 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401800 | (1 of 4) 2.7.10.2//2.7.11.1//2.7.12.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Dual-specificity kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGCGCGTCATTGTTGCCGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1152 |
| LEAP-Seq percent confirming: | 94.6032 |
| LEAP-Seq n confirming: | 894 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATCTGCGAGGTAGGTCAC |
| Suggested primer 2: | ATACCACCCACCTGAAGTGC |