Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.013387 |
Chromosome: | chromosome 9 |
Location: | 747454 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g402450 | (1 of 1) 3.6.4.8 - Proteasome ATPase / RP triple-A protein | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACCAAGCTGTCTTTGGA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1349 |
LEAP-Seq percent confirming: | 99.844 |
LEAP-Seq n confirming: | 640 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGGAAAGGAAGAGAGAGT |
Suggested primer 2: | CTCATTACTGGTCGGTGGCT |