| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.013484 |
| Chromosome: | chromosome 1 |
| Location: | 5117901 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g035600 | MSC2 | Mechanosensitive ion channel; (1 of 3) PTHR30566 - YNAI-RELATED MECHANOSENSITIVE ION CHANNEL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGCAGGATGAGGTGAGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1048 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTTCTTGAACTCAAAGCG |
| Suggested primer 2: | CAATAACGCCCAACTGGACT |