| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.013561 |
| Chromosome: | chromosome 16 |
| Location: | 3215911 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g666500 | BBS8 | (1 of 1) K16781 - tetratricopeptide repeat protein 8 (TTC8, BBS8); Bardet Biedl Syndrome-8 associated protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGCCGGGAGATGCCGCAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 901 |
| LEAP-Seq percent confirming: | 99.7416 |
| LEAP-Seq n confirming: | 386 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTCGAAGCTGACTTGGAA |
| Suggested primer 2: | CTCCCTGACTCTCTTGCCAC |