Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.013604 |
Chromosome: | chromosome 11 |
Location: | 3580678 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g481800 | CHT7 | Compromised Hydrolysis of Triacylglycerols 7; (1 of 3) PF03638 - Tesmin/TSO1-like CXC domain, cysteine-rich domain (TCR) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCAGCGAGGAAGTGCCA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1361 |
LEAP-Seq percent confirming: | 98.6799 |
LEAP-Seq n confirming: | 598 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCATTCTCCCGGTTGTTA |
Suggested primer 2: | GCACTCAGTCGGAGGAACTC |