| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.013696 |
| Chromosome: | chromosome 6 |
| Location: | 7505898 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300500 | ADCY1,CYA18 | Adenylyl cyclase; (1 of 1) PTHR11347//PTHR11347:SF132 - CYCLIC NUCLEOTIDE PHOSPHODIESTERASE // PDE1C, ISOFORM E | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTTGCCTTCCTCATGCAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 695 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCAAACACCCACATCACT |
| Suggested primer 2: | GCTTACGAGACCGAGGTGAG |