| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.013702 |
| Chromosome: | chromosome 2 |
| Location: | 6077377 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g112900 | TPT6,TPT5 | (1 of 3) K15356 - GDP-mannose transporter (VRG4, GONST1); Putative GDP-mannose transporter | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTGACTTTCAACTTCAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1315 |
| LEAP-Seq percent confirming: | 99.4757 |
| LEAP-Seq n confirming: | 1328 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGATTTCACATGCAGGA |
| Suggested primer 2: | CTTGCTTGTCTGCACCACAT |