| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.013742 |
| Chromosome: | chromosome 12 |
| Location: | 8390572 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g548950 | LHCBM7 | (1 of 3) K08913 - light-harvesting complex II chlorophyll a/b binding protein 2 (LHCB2); Light-harvesting Chlorophyll a/b binding protein of LHCII | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGTCAGTATCGAGTTCGCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 699 |
| LEAP-Seq percent confirming: | 98.6301 |
| LEAP-Seq n confirming: | 72 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACATTCTGGCACTTCTGC |
| Suggested primer 2: | GCCTGTGAAAAGAGGCTCAC |