| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.013911 |
| Chromosome: | chromosome 4 |
| Location: | 3718655 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229226 | (1 of 1) IPR015943//IPR017986 - WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCACGCAATGACAGAAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1392 |
| LEAP-Seq percent confirming: | 91.3613 |
| LEAP-Seq n confirming: | 349 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTAGGAAACGGCCAAAATG |
| Suggested primer 2: | GACGTGCGGACGTTTAATTT |