| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.014026 |
| Chromosome: | chromosome 8 |
| Location: | 3631212 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g376250 | (1 of 7) IPR000104//IPR020683 - Antifreeze protein, type I // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCGGGGAGCTGGGAAGAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1207 |
| LEAP-Seq percent confirming: | 99.7079 |
| LEAP-Seq n confirming: | 3072 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGATCTCCGAGTATTTG |
| Suggested primer 2: | ACACCTCCAGGACGTCATTC |