| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.014292 |
| Chromosome: | chromosome 10 |
| Location: | 5440244 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458500 | ASK1,AHD2 | Aspartate kinase; (1 of 1) K00928 - aspartate kinase (lysC) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGGCGCGGTGCTGTGCGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1336 |
| LEAP-Seq percent confirming: | 96.7955 |
| LEAP-Seq n confirming: | 2930 |
| LEAP-Seq n nonconfirming: | 97 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAAAGTTGCATTAGCGACA |
| Suggested primer 2: | GTGAACGAGCTCACGTTTGA |