Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.SG0182.014484 |
Chromosome: | chromosome 9 |
Location: | 7083254 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g411600 | (1 of 3) IPR000104//IPR001005//IPR009057//IPR017877//IPR017930 - Antifreeze protein, type I // SANT/Myb domain // Homeodomain-like // Myb-like domain // Myb domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGCATGGGGCCGCGGCTA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 507 |
LEAP-Seq percent confirming: | 87.7907 |
LEAP-Seq n confirming: | 151 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTGGTGTATGGTTGGCGA |
Suggested primer 2: | GGGATCAAGGGCCAACTACT |