| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.014498 |
| Chromosome: | chromosome 6 |
| Location: | 5010460 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280150 | PSBP9 | PsbP-like protein of thylakoid lumen; (1 of 3) PTHR31407//PTHR31407:SF18 - FAMILY NOT NAMED // PSBP DOMAIN-CONTAINING PROTEIN 4, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCTGCACTCCCGCCCCTT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1323 |
| LEAP-Seq percent confirming: | 99.8891 |
| LEAP-Seq n confirming: | 901 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGTAGTTGCCATCCTGT |
| Suggested primer 2: | CACATGCATCACCCATTAGC |