| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.014565 |
| Chromosome: | chromosome 1 |
| Location: | 1022604 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005850 | CBA2,FAP23 | Cobalamin adenosyltransferase; (1 of 1) 2.5.1.17 - Cob(I)yrinic acid a,c-diamide adenosyltransferase / Cob(I)alamin adenosyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCCATGGCGTCAATCCAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 916 |
| LEAP-Seq percent confirming: | 99.2908 |
| LEAP-Seq n confirming: | 280 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTTAGCAGCGATTATGCG |
| Suggested primer 2: | AAAGGTGAGTGACAGGTGGG |