Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.SG0182.014565 |
Chromosome: | chromosome_1 |
Location: | 1022604 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre01.g005850 | Cobalamin adenosyltransferase and Flagellar Associated Protein | sense | CDS |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | TCATCCATGGCGTCAATCCAG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 916 |
LEAP-Seq percent confirming: | 99.2908 |
LEAP-Seq n confirming: | 280 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTTAGCAGCGATTATGCG |
Suggested primer 2: | AAAGGTGAGTGACAGGTGGG |