| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.014998 |
| Chromosome: | chromosome 1 |
| Location: | 3622865 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g023350 | THO2 | Oligoendopeptidase; (1 of 1) 3.4.24.16 - Neurolysin / Neurotensin endopeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTTCTTGGCTTTTAGCTT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 644 |
| LEAP-Seq percent confirming: | 89.9083 |
| LEAP-Seq n confirming: | 98 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGGGAAGATACGAAGC |
| Suggested primer 2: | GTACGTGTGTGTCTGTCCCG |