| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.015197 |
| Chromosome: | chromosome 14 |
| Location: | 643033 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612200 | CYG16 | (1 of 2) IPR001054//IPR003018//IPR029016//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // GAF domain // GAF domain-like // Nucleotide cyclase; Adenylate/guanylate cyclase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCACCTCTTAATCTGTGTT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1105 |
| LEAP-Seq percent confirming: | 93.5984 |
| LEAP-Seq n confirming: | 965 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCACTCGTTCCAGAAACAT |
| Suggested primer 2: | GCGTGTGTGTGTGTGTGTGT |