| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.015275 |
| Chromosome: | chromosome 1 |
| Location: | 2598420 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015103 | Solute-binding protein-like adenylate cyclase; (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCACAGGCGGAGCCGGGT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1352 |
| LEAP-Seq percent confirming: | 98.5417 |
| LEAP-Seq n confirming: | 473 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAAGACAGCTCGTCACCA |
| Suggested primer 2: | CGTTCACCATGTCTGGAGTG |