Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.015559 |
Chromosome: | chromosome 12 |
Location: | 1941653 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510600 | STK11,STPK11 | Serine/threonine protein kinase; (1 of 1) 2.7.11.1//2.7.11.21 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Polo kinase / Polo-like kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGAGAAGTCCCTCTGAAC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1206 |
LEAP-Seq percent confirming: | 98.513 |
LEAP-Seq n confirming: | 265 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACTCGGTCTCACTTAGGC |
Suggested primer 2: | TGTTCAACACACCCGGTCTA |