| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.015800 |
| Chromosome: | chromosome 13 |
| Location: | 923306 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g567950 | STA1,AGP1 | ADP-glucose pyrophosphorylase large subunit; (1 of 1) PTHR22572:SF119 - GLUCOSE-1-PHOSPHATE ADENYLYLTRANSFERASE LARGE SUBUNIT 1, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACCCACCACAGGCAAGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1287 |
| LEAP-Seq percent confirming: | 96.3696 |
| LEAP-Seq n confirming: | 1168 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAATTCTGTTCCAACGCC |
| Suggested primer 2: | ACGCACTCAGCATCCTTCTT |