Insertion junction: LMJ.SG0182.015826_1

Overview

Insertion cassette:pMJ013b
Side of cassette:3'
Strand:+
Strain:LMJ.SG0182.015826
Chromosome:chromosome_10
Location:1637710
Confidence (%):75
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGCACGCGGTGACGACCGCT
Internal bar code:

Confirmation - LEAP-Seq

LEAP-Seq distance:551
LEAP-Seq percent confirming:97.2222
LEAP-Seq n confirming:70
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:

Suggested primers for confirmation by PCR

Suggested primer 1:CGTGGCAGACGTACTCAGAA
Suggested primer 2:ACTGCCCACTCTGGCTTCTA