| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.015843 |
| Chromosome: | chromosome 13 |
| Location: | 745416 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g566650 | LCS2 | Long-chain acyl-CoA synthetase; (1 of 1) 2.7.8.11//6.2.1.3 - CDP-diacylglycerol--inositol 3-phosphatidyltransferase / Phosphatidylinositol synthase // Long-chain-fatty-acid--CoA ligase / Lignoceroyl-CoA synthase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCCACTGCTACAGCCGCT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1269 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 316 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTTGCAACAAATCCAGCA |
| Suggested primer 2: | AATATCAACAGGGGAAGGGG |