| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.016221 |
| Chromosome: | chromosome 12 |
| Location: | 2726894 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g503500 | GLG1 | Similar to Golgi apparatus protein 1; (1 of 4) K06816 - golgi apparatus protein 1 (GLG1, ESL1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGCCGCTGTCGCTTGAAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1313 |
| LEAP-Seq percent confirming: | 99.8888 |
| LEAP-Seq n confirming: | 898 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGCTCAAGCTGTTCTGC |
| Suggested primer 2: | TTTGGTTTAGTTTGGGCTGG |