| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.016239 |
| Chromosome: | chromosome 6 |
| Location: | 4858737 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278700 | Conserved Ankyrin-Repeat Protein; (1 of 1) PTHR24193:SF69 - IQ MOTIF AND ANKYRIN REPEAT DOMAIN-CONTAINING PROTEIN LOC642574 HOMOLOG-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACACAATCAGTGTCTGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1363 |
| LEAP-Seq percent confirming: | 99.1632 |
| LEAP-Seq n confirming: | 474 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACCTGACCTGACCAACTT |
| Suggested primer 2: | CAACATTGCAGCACACACTG |