Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.SG0182.016289 |
Chromosome: | chromosome 8 |
Location: | 1934543 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g367350 | (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCAGTGCACGGGCGCCT |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 507 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACACACCGCACACACACAC |
Suggested primer 2: | ACACAAGCACACACAGGAGC |