| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.016331 |
| Chromosome: | chromosome 6 |
| Location: | 5812686 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g287650 | (1 of 1) 2.1.1.43//6.3.2.19 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase // Transferred entry: 2.3.2.23, 2.3.2.27 and 6.2.1.45 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATTAATGGTTGGTCTTATG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 977 |
| LEAP-Seq percent confirming: | 92.4242 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTATTCCGCTGGTGTCTGG |
| Suggested primer 2: | ATGGTCTATGTAGCCCGACG |