| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.016545 |
| Chromosome: | chromosome 17 |
| Location: | 2543219 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g716500 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCCTGATACCGGTACGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1094 |
| LEAP-Seq percent confirming: | 97.453 |
| LEAP-Seq n confirming: | 2487 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTGACTACCCTTTGACCA |
| Suggested primer 2: | TCTCAGTTGCTCGATGTTGG |