| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.016566 |
| Chromosome: | chromosome 1 |
| Location: | 333583 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g002050 | APT1 | Acid phosphatase; (1 of 1) K01078 - acid phosphatase (E3.1.3.2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGATCGGCGACTCGCCCAAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1009 |
| LEAP-Seq percent confirming: | 99.1905 |
| LEAP-Seq n confirming: | 1838 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAAATCGTGAACTGAGCG |
| Suggested primer 2: | ATAACTACCCCAAGCCCCAC |