Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.SG0182.016883 |
Chromosome: | chromosome 3 |
Location: | 4874690 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g179300 | SRH6 | (1 of 1) K11367 - chromodomain-helicase-DNA-binding protein 1 [EC:3.6.4.12] (CHD1); SNF2-related DNA/RNA helicase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTGGCAGGCAGCATTCTGC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 663 |
LEAP-Seq percent confirming: | 85.3659 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGTAGCCAGGGGTGAGTG |
Suggested primer 2: | AGAACACACGCCCTCACTCT |