Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.SG0182.016888 |
Chromosome: | chromosome 1 |
Location: | 2553095 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g014800 | MSH7,CPL21 | putative MutS type 2 DNA repair protein; (1 of 1) K07456 - DNA mismatch repair protein MutS2 (mutS2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAAGTCATCACGCACGCAG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 630 |
LEAP-Seq percent confirming: | 94.5946 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGTGCCTCCTCTTTTGAG |
Suggested primer 2: | ACTTCACCGTCACCATGTCA |