| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.017321 |
| Chromosome: | chromosome 3 |
| Location: | 1303173 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g150400 | PIGU1,PIGU,LRG5 | GPI transamidase subunit PIG-U; (1 of 1) K05293 - phosphatidylinositol glycan, class U (PIGU) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCAGCTGTGGTCTGTGGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 660 |
| LEAP-Seq percent confirming: | 93.4426 |
| LEAP-Seq n confirming: | 171 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGGCCTACCGAGATTATT |
| Suggested primer 2: | CTAATAACGACCCGCACGAT |