| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.017385 |
| Chromosome: | chromosome 9 |
| Location: | 2098783 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393850 | MAPKKK2,PTK28,MAPKKK2 | Mitogen-Activated Protein Kinase Kinase Kinase; (1 of 1) IPR000719//IPR001229//IPR001245//IPR002290//IPR011009//IPR020635 - Protein kinase domain // Jacalin-like lectin domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACTTTGGCATCACATGT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 687 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 62 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGTTACGTGAGCGACAGG |
| Suggested primer 2: | CACACGCATCCAACAAATTC |