Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.017390 |
Chromosome: | chromosome 1 |
Location: | 6180142 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g044250 | CAM4 | Calmodulin-like protein; (1 of 8) 2.4.1.5 - Dextransucrase / Sucrose 6-glucosyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTCCAGCTGCCTGCCCA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1381 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 205 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTAGTGGTGGCAAATGGAT |
Suggested primer 2: | ACTCCGTCCTGGTTCATGTC |