Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.SG0182.017434 |
Chromosome: | chromosome 2 |
Location: | 453744 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g076400 | VPS25 | Subunit of ESCRT-II complex; (1 of 1) K12189 - ESCRT-II complex subunit VPS25 (VPS25, EAP20) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGAACATTGACCTGCAAG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 704 |
LEAP-Seq percent confirming: | 96.9697 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAACTGCTCAGCCAGAATC |
Suggested primer 2: | GTGTGTCCCCACTTGCTTTT |