| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.017445 |
| Chromosome: | chromosome 12 |
| Location: | 8743235 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g545800 | ROC55,ROC11 | Rhythm Of Chloroplast 55; (1 of 24) IPR006553 - Leucine-rich repeat, cysteine-containing subtype | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGTCAGCGGTAACAGTTC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 831 |
| LEAP-Seq percent confirming: | 98.8764 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGACGTCCACTCCATGAC |
| Suggested primer 2: | CGGTCCTCATCAGTTTTGGT |