| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.017616 |
| Chromosome: | chromosome 9 |
| Location: | 1505452 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398050 | (1 of 30) PF13450 - NAD(P)-binding Rossmann-like domain (NAD_binding_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCACAGGAGGCGAGGGCGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 555 |
| LEAP-Seq percent confirming: | 91.3979 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGGCTAGAGGAGTTCAGC |
| Suggested primer 2: | TGCTGCAACGAGACGTTTAC |